Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15055C10
Clone ID IST15055C10
Vector VICTR80
Project tigm

Sequence tag IST15055C10BBF1
Sequence
CTAGTACCCTCATCTTCTCTGAAAAACGGTAGACAGGCTCTCATAGGAAAAACCCTCATATGTCCTCACTTACTTTGTAA
ATGTCCTTACAATTAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106991274..106991373 100
NO GENE  


Sequence tag IST15055C10HMR1
Sequence
NNAGGAGTGGTTAAATTTAAGTGTTTTCATTTATAACTGCTTAAGATCCTAACTGCTGCAAGTATGAGAATTAAGCCAGA
TTAGATTGGTTC
Sequence Type genomic DNA
Unitrap ID UNI18463

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106991187..106991275 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040481 (Bptf) bromodomain PHD finger transcription factor Gene [Source:MGI (curated);Acc:Bptf-002]


Sequence tag IST15055C10HMF1
Sequence
CTAGTACCCTCATCTTCTCTGAAAAACGGTAGACAGGCTCTCATAGGAAAAACCCTCATATGTCCTCACTTACTTTGTNA
ATGTCCTTACNATTANATCTTAATTTTATCAATCNGGTGAATAAAAACTTAANAAAAAGCCTGAAAGTCTGTTGCTNNNA
NTTAANGGTCCCCCCCCCCCNNAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000040481


For any suggestions or comments, please send an email to unitrap@crg.es