Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15024A1
Clone ID IST15024A1
Vector VICTR78
Project tigm

Sequence tag IST15024A1HMF1
Sequence
CCTGCTGGCCCCTAAACCCCTTTTTTTNNTCTCCAGTCNCCCCTAANAAANCNCCTCAANGNNNNNATTNNTGCCTGAGT
CANNAGTCTACCACACTCACCTTCTAAACCCCNCGCTGCCCAGCTTATACCCATTCCCTGCTCCTGGCACCNTGCCCCAT
AACCAACCGACCTGCCCTCCTCCNACTTANGGGCCGCCCCTGGGCTCCTGAAGGCTGGCCGCNCCTTCNGGGTGTCACGG
CTGCCCTGTCCNTNCNANATAATGGCGCCANATTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15024A1BBF1
Sequence
CCTGCTGGCCCCTAAACCCCTTTTTTTCATCTCCAGTCACCCCTAACAAACCTCCTCAAAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI30001

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69499200..69499264 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018752 (Tnfsf12) NM_001034097 tumor necrosis factor (ligand) superfamily, member 12 Gene [Source:MGI (curated);Acc:Tnfsf12-002]


Sequence tag IST15024A1HMR1
Sequence
CTGTANATGCAGGCAACCCCAACCTCCANAACTATAAACACAGTAAACTTTTATGCTTTATAAATTATCCAGGCTCTGAA
AATAAGCTACAGCAACAACAGGAGCAACAAACAGATGGAGATAGCAGGGATCCAAAAATTCCAGCAGCACAAGTCTGGGT
TAAAAGATCAGAGGGGCCAGAGTGTGGATTTTCCTCTCTGAANCCACAAAAAAGAGAGAAAAATAAAGTTTGGAATTCTC
GATGAAACTGGCAGGTCCTGGCCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 130354785..130355048 258
NO GENE  

 
Come back to gene ENSMUSG00000018752


For any suggestions or comments, please send an email to unitrap@crg.es