Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10169F9
Clone ID IST10169F9
Vector VICTR76
Project tigm

Sequence tag IST10169F9HMF1
Sequence
GTTGGAGGTTACTTCTATTAAAATAAGACTTGCCGGGCATGGTGGCGCACGCCTTTAATCCCAGCACTCAGGAGGCAGAG
GCANGCAGATTTCTGGA
Sequence Type genomic DNA
Unitrap ID UNI31953

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 39477677..39477772 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037386 (Rims2) NM_053271 regulating synaptic membrane exocytosis 2 Gene [Source:MGI Symbol;Acc:MGI:2152972]


Sequence tag IST10169F9BBF1
Sequence
GTTGGAGGTTACTTCTATTAAAATAAGACTTGCCGGGCATGGTGGCGCACGCCTTTAATCCCAGCACTCAGGAGGCANAG
GCAGGCAGATTTCTGGCCAGCCTGGTCTACAGAGTGAGTTGCAGGACAGCCAGGGCTACACAGAGAAACCCTGTCTCAAA
AAACAAAACAAAACAAAACAAAACANANACNANNNCNNAAGACTTTTGTGATGGGCGTAAGGCCCACAAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI31953

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 39477677..39477910 216
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037386 (Rims2) NM_053271 regulating synaptic membrane exocytosis 2 Gene [Source:MGI Symbol;Acc:MGI:2152972]

 
Come back to gene ENSMUSG00000037386


For any suggestions or comments, please send an email to unitrap@crg.es