Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11696G3
Clone ID IST11696G3
Vector VICTR76
Project tigm

Sequence tag IST11696G3HMR1
Sequence
GGATCTGCTTCTGACTGTGGAGCACGTTCAGGAGTGATGGATGGAATCCGTCAGTTGGCAGTGGGTAATCTGTTGGTGTA
ATCTTGTCCTCTTAGTAATCATTCCAAGAGATGTGGAACAATAAGCAACAACTTATGGCTCCCACAGATTTATCCCCTAN
GGCAGAGTAAAAAACTCATAAAGGAAAGTAAGCCATGGTCTTANAATTTGAATANCATCCTGGGGACAGCAAAGGTGGTC
ACACCATGGAGCTTTACCAGGGATGTTAAGCAACTGCTCANTGAGTGTTGTCTGAGGCCTGGCTGTNATGAAGGACACCT
GGAAGGTGTGTTGTGN
Sequence Type genomic DNA
Unitrap ID UNI10404

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 62954771..62955105 325
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021932 (Rnaseh2b) NM_026001 ribonuclease H2, subunit B Gene [Source:MGI (curated);Acc:Rnaseh2b-001]


Sequence tag IST11696G3HMF1
Sequence
ATCCTACAGCCATCTGAGAAAGGTCAGCGGGGCCCCACCAAGAAACGCTGTATAAAGACAAAGCCAGGTTCACTCGTGTG
GAAAATGTTAAATGTGAGCCATGCTGGACAACCCANAAATGGCCTGCAGGAAATGATGAGCAATCTTCCAAGAAGCTGAG
CAGACGTATTCTCAAGGCCACACATGGAGTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 62954583..62954774 190
NO GENE  

 
Come back to gene ENSMUSG00000021932


For any suggestions or comments, please send an email to unitrap@crg.es