Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XS0251
Clone ID XS0251
Vector pGT0lxf
Project sanger

Sequence tag XS0251
Sequence
CGCTAGTATTATTCAGTGCCACATCCTAAATGACAAGCGACACATATTAACCAAAGATACGAATAACAATGTGGCGTACT
GGGATGTATTGAAG
Sequence Type mRNA
Unitrap ID UNI2565

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 119822750..119822843 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032512 (Wdr48) NM_026236 WD repeat domain 48 Gene [Source:MGI Symbol;Acc:MGI:1914811]

 
Come back to gene ENSMUSG00000032512


For any suggestions or comments, please send an email to unitrap@crg.es