Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST3205-NL
Clone ID PST3205-NL
Vector U3NeoSV1
Project escells

Sequence tag PST3205-NL
Sequence
ACGTCCTATATTTATTCTGTAGTTTAAAAAGATAATAGGGAC
Sequence Type genomic DNA
Unitrap ID UNI81

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 8509980..8510021 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027500 (Stmn2) NM_025285 stathmin-like 2 Gene [Source:MGI Symbol;Acc:MGI:98241]

 
Come back to gene ENSMUSG00000027500


For any suggestions or comments, please send an email to unitrap@crg.es