Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST4266-NL
Clone ID PST4266-NL
Vector U3NeoSV1
Project escells

Sequence tag PST4266-NL
Sequence
CATGTAACTTTCCCCTTAGTACTAGAGGATTTAGTTAGCTTAGGAT
Sequence Type genomic DNA
Unitrap ID UNI14985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32349253..32349298 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024002 (Brd4) NM_198094 bromodomain containing 4 Gene [Source:MGI (curated);Acc:Brd4-003]

 
Come back to gene ENSMUSG00000024002


For any suggestions or comments, please send an email to unitrap@crg.es