Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13201B6
Clone ID IST13201B6
Vector VICTR74
Project tigm

Sequence tag IST13201B6HMR1
Sequence
ACCTTAAACACTAAATGTGTGGTGATCCTACTGCCTCTGTCTCAGGCTCTAGGATTCCAGGGTGTGCACCACCACACCTG
GTTGCTGAAGCATATAGCTTGACATAACCTGCAAATATTCTTATATGTGGCTTCTTCAAATTCTGTAAATGGACCCTGTC
TCAAGTAGTAGAAACAGCAATTCTTTTCCTCCACTAGAAGTAGATATTTCTTGGGCCTGTTTCACCAGTTACTTCAAGAA
ACTTGGTCCTGACTAGGGAGGTTCAGTTTCCTGTGTACCACATATTAGCTTTTCATCACTATAAGAAAGTAGTCAAGGTA
GTCC
Sequence Type genomic DNA
Unitrap ID UNI1099

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 132327576..132327898 323
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043384 (Gprasp1) NM_001004359 G protein-coupled receptor associated sorting protein 1 Gene [Source:MGI (curated);Acc:Gprasp1-001]

 
Come back to gene ENSMUSG00000043384


For any suggestions or comments, please send an email to unitrap@crg.es