Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12891D8
Clone ID IST12891D8
Vector VICTR76
Project tigm

Sequence tag IST12891D8HMF2
Sequence
CCATGACAGATGGCTGTGAGCCACCNNGNGGTTGCTGGGAATTGAACTCAGGACCTCTGGAANAGCAATCGGTGCTCTTA
ACCACTGAGCCAGCTCTCCAGCCTGACTCTCAGGCAAGGCGTACAACCCAGAAAACCGGTGTGAGCAGTTTATTGTTGTT
TTTAATACTTATTTTTATTTTATGTATATGAGGATTTTGCCTGCATGTATGGCTGTGAAACTGGTGANTGCCTGGTGCCT
GAAATGCCNNANNANGNTGCCANATCCCCCAAAACTGANNTTGTGAAACACTTGTGAACTGCCNGCCATGTGGGTGCTTG
NAAACTGAANNNNNGTCCTCTGGAANNNCANTCCNTGAGTGCTCTTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12891D8BBF1
Sequence
CACCCGNNNNNNCTTCCGAAGGTCCGGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCCGTAAGGAGATCT
GT
Sequence Type genomic DNA
Unitrap ID UNI1659 UNI28434 UNI30594 UNI34522

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 79508099..79508167 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 19068578..19068646 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021775 (Nr1d2) NM_011584 nuclear receptor subfamily 1, group D, member 2 Gene [Source:MGI Symbol;Acc:MGI:2449205]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 98877090..98877158 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46320596..46320664 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023953 (Polh) NM_030715 polymerase (DNA directed), eta (RAD 30 related) Gene [Source:MGI Symbol;Acc:MGI:1891457]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 78079927..78079995 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025429 (Pstpip2) NM_013831 proline-serine-threonine phosphatase-interacting protein 2 Gene [Source:MGI Symbol;Acc:MGI:1335088]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6138375..6138443 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180925038..180925106 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 153502196..153502264 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 91607668..91607736 69
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114079695..114079763 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033545 (Znrf1) NM_133206 zinc and ring finger 1 Gene [Source:MGI Symbol;Acc:MGI:2177308]

 
Come back to gene ENSMUSG00000033545


For any suggestions or comments, please send an email to unitrap@crg.es