Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14733G2
Clone ID IST14733G2
Vector VICTR76
Project tigm

Sequence tag IST14733G2HMF1
Sequence
CACTACCCTTTAAAATTTTCCCACTCTTTACAAAGCCTCCTCGTTCTCTAACCTTCCTAGCCACGTCCACGTTGTTTTCT
TCAAAAGGTGTTCTCAAGCTCTCCCTCAATCCTCTCCAAGCCTGCGCACTACAGACTAAGGCCCTCCTACTGTTGCTTGG
GCGTGGGCTGCCTCTTTCAAGCCCCTCCCTCTCTTCCCTAAGCTCTTGATTCTCTTTTAAACAAGTGCCTTCACCTCGTG
CTTCTAGGGAGCTCACACTAGTTCTGTAGTTTCAGAAACAAAACCTTTTTACCAATGAAATGGGAATGCCAGTGTTTCCT
TCATACAGTGATGGTGTGAGCTAAGTAAAACTGTAGCAAGCTGTACAACGCACTTAGGAAAGCCGANGCACAGGAAAGAC
GTAACTGANCAGTTTGACCAAGTTCCTCTTANTTTCTTTATTCTCATATGCTTCTNANTTNACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4964759..4965221 451
 
EST/CDNA Est Name
  BE690390.1 - BB650646.1 - BI146423.1 - BU609308.1 - BU504265.1 - BY719640.1 - BG246160.1 - CF173232.1 - BX514734.1 - AI788429.1 - CA870701.1 - CK620966.1 - CA531329.1 - BU840615.1 - CA531195.1 - BY777023.1 - BE284592.1 - CJ058711.1 - BY175224.1 - BY198111


Sequence tag IST14733G2HMR1
Sequence
AGTGGTTGCAGCTCGGTGGTGGGGGTGGCTTAGCACTTTGAGAGTCTACCTGGGCCAACTGCTTCTGAGCCAAGAGAGCC
GAGGGAAGGGATGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI513

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4964666..4964762 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061374 (Fiz1) NP_001103799 Flt3 interacting zinc finger protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344336]

 
Come back to gene ENSMUSG00000061374


For any suggestions or comments, please send an email to unitrap@crg.es