Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13030B2
Clone ID IST13030B2
Vector VICTR76
Project tigm

Sequence tag IST13030B2BBF1
Sequence
TTATCCATCTGGGTCAAAGGCCTATCTGGTAGGCCTGTGTTTTGACTCTGGCTTGGGGAGAATAGTGGAAGGACTAGCCN
ANTTTTAAGTACTTTGCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI32007

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58159239..58159341 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032334 (Loxl1) NP_034859 lysyl oxidase-like 1 Gene [Source:MGI Symbol;Acc:MGI:106096]


Sequence tag IST13030B2HMF1
Sequence
TTATCCATCTGGGTCAAAGGCCTATCTGGTAGGCCTGTGTTTTGACTCTGGCTTGGGGAGAATAGTGGAAGGACTAGCCA
AGTTTTAAGTACTTTGCAGATCTAGCTGGGGTCATCTANGGACNAGTGGGGAAAGTCTTGCTCCCTTGCTTCTCCCTCTC
CCAGGGAATCTCTTAACACTTTTAGAAATTTCCCCTATGCCTGTGCACAAAGTGAGGCAAAGGATCATGGGAGTCTTGGA
CCTTCAGGGTCAAGAGGCCTTAANAATGCTTCTANAGCCGGGCGTGGTGGCGCACGCCTTTAATCCCAGCACTCGGGANG
CANANGCAGGTGGATTTCTGANTTCNANGCCANCCTGATCTACAAACTGANTTCCNNGNCANCCNGGGCTATACAGANAA
ACCCTGTCTCGAAAAACCNAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13030B2HMR1
Sequence
TAATAGTTGGATTCNGGAGGAGAGGCACGCAGGGGCTGCATGGTCCTTGTTAAGCCACCACTGGAAGGCCTTTGATAANA
AACAAACAGGGTCCGCACCAGCAATTCACCAGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58159339..58159451 109
 
EST/CDNA Est Name
  AA049290.1

 
Come back to gene AA049290.1


For any suggestions or comments, please send an email to unitrap@crg.es