Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST0084-NR
Clone ID PST0084-NR
Vector U3NeoSV1
Project escells

Sequence tag PST0084-NR
Sequence
TCCTCACATCCCCATCTTTTTAAACAGAGTAAAGCACCCACAGACACATG
Sequence Type genomic DNA
Unitrap ID UNI9296

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 24082160..24082209 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028953 (Abcf2) NM_013853 ATP-binding cassette, sub-family F (GCN20), member 2 Gene [Source:MGI Symbol;Acc:MGI:1351657]

 
Come back to gene ENSMUSG00000028953


For any suggestions or comments, please send an email to unitrap@crg.es