Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XS0236
Clone ID XS0236
Vector pGT0lxf
Project sanger

Sequence tag XS0236
Sequence
CGGGCCCGAAAAAGGAAGGATCGGCTGCCGTCGCTGCCAAGTCCGCGCCCGCTCTTCTTTGCTGTCTCCGGCCCGGCCCG
GCCGTGCCGCCTTTTCTTGCCGTCTCCCTCCTCGGCCGTCCCCGCGTGTTTTGCGCGGTCGCCGGGCACCGGGGCTGCGG
CGACGAGCCCGCGGGCGGCCGGTCGGGCGGGGCGGGCGGCTGACAGCGTCCTGAGGTTAGCATTATACTTTTCCAGTGGA
GCCCATGACTTCTGATCAGGACGCTAAAGTTGTGGCTGAACCGCAGGCACAGCGAGTCCAGGAGGGCAAGGACAGCTCTC
ATCTG
Sequence Type mRNA
Unitrap ID UNI2568

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 9093221..9121472 206
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033499 (Larp5) NM_172585 La ribonucleoprotein domain family, member 5 Gene [Source:MGI Symbol;Acc:MGI:106330]

 
Come back to gene ENSMUSG00000033499


For any suggestions or comments, please send an email to unitrap@crg.es