Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST2015-NR
Clone ID PST2015-NR
Vector U3NeoSV1
Project escells

Sequence tag PST2015-NR
Sequence
CAGACAAAGGAGGCCATGAGGTTTCTTGCTTTTCTTCTCAGGCATG
Sequence Type genomic DNA
Unitrap ID UNI5206

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95463643..95463688 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038612 (Mcl1) NP_032588 myeloid cell leukemia sequence 1 Gene [Source:MGI Symbol;Acc:MGI:101769]

 
Come back to gene ENSMUSG00000038612


For any suggestions or comments, please send an email to unitrap@crg.es