Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10591C7
Clone ID IST10591C7
Vector VICTR76
Project tigm

Sequence tag IST10591C7BBF1
Sequence
ACCNCATGGTGGCTCACAACCACCCATAGTGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI18965 UNI30540 UNI34791

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 94895667..94895704 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 85398760..85398797 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059439 (Bcas3) NM_138681 breast carcinoma amplified sequence 3 Gene [Source:MGI (curated);Acc:Bcas3-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 72905271..72905308 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 62669033..62669070 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 17566402..17566439 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047786 (Lix1) NM_025681 limb expression 1 homolog (chicken) Gene [Source:MGI (curated);Acc:Lix1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5149615..5149652 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 122042215..122042252 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 21666479..21666516 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028252 (Ccnc) NM_016746 cyclin C Gene [Source:MGI (curated);Acc:Ccnc-008]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 109677353..109677390 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 60399928..60399965 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 89793011..89793048 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_072868: 1474..1511 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_110857: 18109..18146 36
NO GENE  


Sequence tag IST10591C7HMF1
Sequence
ACCNCATGGTGGCTCACAACCACCCATAGTGAGATCTGATGCCCTCTTCTGGTGCATCTGAAGACAGCTACAGTGTACTT
AGATACAATAATAAATAAAAATCTTAAAAAAATATTTTTTAAAAAAAAAGTGGGATGATGAGATCCAGGGGCAGATGTGA
TGGTGGGGGGTACTTTAGGGGGAANAAAAGCAAANGTGGGGNAATGGATTTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 53701713..53701940 220
NO GENE  

 
Come back to gene ENSMUSG00000028252


For any suggestions or comments, please send an email to unitrap@crg.es