Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14263C11
Clone ID IST14263C11
Vector VICTR74
Project tigm

Sequence tag IST14263C11HMF1
Sequence
AGACTTGGGGCTCTTTGTATCCTGGTGCCCCGTGGTTCTCTCACCCTGTGTGACTTAGCTCTCAGTGTGGCAGCAGGCAG
CCCTGTGAAGCACAGTAGGTTAGAACAGCAGACGCCGATGTCTTCCTAAGCGTCCCCAAGGCAGGTATTTGATTGCAGCA
GTGTTGGCCTCGGCTCCATTAAGCTTCAGAACCAAGGCAGAAGAAAGGATTTCCATGGTAGAAGCTTAAAGCAAGAGGTT
GGGGGGATCGGAAGAATCAGAGAGCAGTTAAGACTTACGTTGTCTCTGCCACATTCACTANTGTTAGCNNGTCAGTTTGC
ATGATTCNNGGTTGGGGAAGTNNCNCNNCACACNNACT
Sequence Type genomic DNA
Unitrap ID UNI24544

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66499083..66499435 333
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019873 (Reep3) NM_178606 receptor accessory protein 3 Gene [Source:MGI Symbol;Acc:MGI:88930]


Sequence tag IST14263C11HMR1
Sequence
GTCTGAGTTCTTGTGGTAAGGCAGACGGCCNGGATCAGTGAGGAGCAATAAGCGCACAGTCAGCAAAGATTCTCTGCCTC
AGTGCACCTTAATGGAGGGCATGGACTCTCACTATTGAAAAACACAGAATAAGCCCCAACCACTGCGTGTGAGCATGCAG
GTGTGTACGACATATGGCAGGGTGTGAGCCCCCATGGCACATGTGCGGAGATCAGAGGACAACTTTCAGGAGTCGGCCCT
CTCCATCCANATGGAACTCTGGTTGTAAGACATGCTTGNANNGCNTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66499432..66499718 275
 
EST/CDNA Est Name
  BI794055.1 - BY280981.1 - BB848313.1 - BB858436.1 - AI152361.1 - AI322473.1 - CJ184231.1 - AA445369.1 - BY168997.1 - BY179427.1 - BF470037.1 - CJ171218.1 - CJ171336.1 - CJ172146.1 - CJ170013.1 - BY336090.1 - BY329778.1 - CJ179710.1 - CJ180312.1 - BY009720


Sequence tag IST14263C11BBF1
Sequence
AGACTTGGGGCTCTTTGTATCCTGGTGCCCCGTGGTTCTCTCACCCTGTGTGACTTAGCTCTCAGTGTGGCAGCAGGCAG
CCCTGTGAAGCACAGTAGGTTAGAACAGCAGACGCCGATGTCTTCCTAAGCGTCCCCAAGGCAGGTATTTGATTGCAGCA
GTGTTGGCCTCGGCTNNNNTNNNCTTCAGAACCAAGGCAGAANANNGGATTTCCNTGGTAGAAGCTTAAANCANNANGTT
GGGGGGATCGNAANANNCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene BI794055.1 - BY280981.1 - BB848313.1 - BB858436.1 - AI152361.1 - AI322473.1 - CJ184231.1 - AA445369.1 - BY168997.1 - BY179427.1 - BF470037.1 - CJ171218.1 - CJ171336.1 - CJ172146.1 - CJ170013.1 - BY336090.1 - BY329778.1 - CJ179710.1 - CJ180312.1 - BY009720


For any suggestions or comments, please send an email to unitrap@crg.es