Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14678C9
Clone ID IST14678C9
Vector VICTR74
Project tigm

Sequence tag IST14678C9BBF1
Sequence
AGTGATGCAGAGGCAATTTGAAGTATATGAGAAGGTACTGTGATCTTTTATGTGAGGGATTTGAGGATTTACAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 99316749..99316827 79
NO GENE  


Sequence tag IST14678C9HMF1
Sequence
AGTGATGCAGAGGCAATTTGAAGTATATGAGAAGGTACTGTGATCTTTTATGTGAGGGATTTGAGGATTTACAGATCTGG
GGTCTTGAAAGCTTGAAATCCTGTCTTGGATACCAACCGGATAACTTAACAGATTTGCATCCTGGAACAATTTGACAGTA
TTAACATCCCTCACAAAACAAAATACTCAGCTGCCTGAAAATACTCTCTCCACTTTCGTTTACTCTCTCTGAGGTGGGGC
TGGATGTGGCTGCAGCCCCAGAATCAACACGGGGGATGAGCTACAGCTTGGGTCTGTGCCNNNNCATACAAGGTTCACAG
GGGAGTTGCANGACCACNNANNTGNGCAAACANGAANGGCAGACATCNNNNNCNNNGNNNCTNNGGTCNNTGAANCCTGG
TGCCACTGCNNNTTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14678C9HMR1
Sequence
ACTTACAAGCCCAAGACAATGTATATGCTGCATAAATATCATAGTACTTAAGGAATAACGGGAAGAAAAATGGTCCATAT
ATATGTCAGGATAAAAATAAATATTAAGAGGCAGGATCTCCCATATTTACTATAGCTAGCCTCCAATGTACTATAGCTAA
GGACTACCTTGGACTTCTGACCTTCCTGCACCTACCTCCCTGGTGCTGGAGTTACAGACATGCTTTGCGCATCCAGTTTC
CTGGTGCTGGGGGTTTAGTGTGCACAAAGCATGCACTCTAAAAGCCCANCTACAGAGCCNACCCCANANACTTTGTTTTC
ANATGCAAAAATGTTTTATTAACACATCCTATGCAAAGGATAANAGAGTGATAACCTTGAGTATTGTATGGTGATACNGA
NGTNGAAATTCAACCTCN
Sequence Type genomic DNA
Unitrap ID UNI12825

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 99316335..99316751 399
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032470 (Mras) NM_008624 muscle and microspikes RAS Gene [Source:MGI (curated);Acc:Mras-001]

 
Come back to gene ENSMUSG00000032470


For any suggestions or comments, please send an email to unitrap@crg.es