Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST4790-NR
Clone ID PST4790-NR
Vector U3NeoSV1
Project escells

Sequence tag PST4790-NR
Sequence
GTTGGTGGTGTGGTACAGTTCAGTCACAGCCACCTTAGCATG
Sequence Type genomic DNA
Unitrap ID UNI14855

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 155818013..155818054 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067194 (Eif1ay) NM_025437 eukaryotic translation initiation factor 1A, Y-linked Gene [Source:MGI (curated);Acc:Eif1ay-001]

 
Come back to gene ENSMUSG00000067194


For any suggestions or comments, please send an email to unitrap@crg.es