Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12125H10
Clone ID IST12125H10
Vector VICTR76
Project tigm

Sequence tag IST12125H10HMR1
Sequence
ATAATGTGGTAAATTTTTTCCACAGCATTGTCAGAGATAATAGCTATATTAACCAGGAGTGGTTACCCTTTTACTCCCGG
TGCTTCAGAGGCAGAAACAGGTGAATCTCAGAAACAGGTGAGGTTGAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGGC
AGCCAGGGTACACAGAGTAACCCTTTCTCAAAAACCTACCACCATCACCACCATCAAAGCTGTATTAAATATAGCTCACA
TAGAAAGTC
Sequence Type genomic DNA
Unitrap ID UNI29864

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11706763..11707010 248
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035455 (Fignl1) NM_021891 fidgetin-like 1 Gene [Source:MGI (curated);Acc:Fignl1-001]


Sequence tag IST12125H10BBF1
Sequence
CAACCATGGGGACTTAATCTCTTCTCCAAAGGACAATCTGCCTTGATGTCCCCATGANCCACAAATCTAAGACCTTTCAA
AAGAAAAAAAAAAAAAAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 125681973..125682069 95
NO GENE  

 
Come back to gene ENSMUSG00000035455


For any suggestions or comments, please send an email to unitrap@crg.es