Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13963H4
Clone ID IST13963H4
Vector VICTR74
Project tigm

Sequence tag IST13963H4HMF2
Sequence
TCACTANACCTCTCCNAAACCCATTTTACAGACAAGGAACTCAAGTCTCANAGGGGAGCTGGTGTGAACAATTAGTGTCC
TCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 132549743..132549824 76
NO GENE  


Sequence tag IST13963H4BBF1
Sequence
ACTGCTCTTTCGAAGGTCCAGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCCGTAAGGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI17032

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 20191088..20191162 75
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041215 (Yeats2) NM_001033237 YEATS domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2447762]

 
Come back to gene ENSMUSG00000041215


For any suggestions or comments, please send an email to unitrap@crg.es