Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST3310-NR
Clone ID PST3310-NR
Vector U3NeoSV1
Project escells

Sequence tag PST3310-NR
Sequence
GAGGTCAGCCTGGTCTACAGAGTGAGTTCCAGGACATG
Sequence Type genomic DNA
Unitrap ID UNI14991

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 63238336..63238372 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 5129207..5129243 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 29104159..29104195 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 76641071..76641107 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051747 (Ttn) NM_011652 titin Gene [Source:MGI (curated);Acc:Ttn-019]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 11888020..11888056 37
NO GENE  

 
Come back to gene ENSMUSG00000051747


For any suggestions or comments, please send an email to unitrap@crg.es