Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14745A8
Clone ID IST14745A8
Vector VICTR76
Project tigm

Sequence tag IST14745A8BBF1
Sequence
GTTCGATTAGTCTTTCGCCCCTATACCCAGGTCGGACGACCGATTTGCACGTCAGGACCGCTNCNGACCTCCACCAGAGT
TTCCTCTGGCTTCGCCCTGCCCAGGCATAGTTCACCATCTTTCGGGTCCTAACGCGTACGCTCGTGCTCCACCTCCCCGG
CGCGGCGGGCGAGACGGGCCGGTGGTGCGCCCTCGGCGGACTGGAGAGGCCNNNGGATCN
Sequence Type genomic DNA
Unitrap ID UNI30685

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 57391472..57391690 207
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075007 (AC144776.2) FIL1L_MOUSE Isoform 2 of Q6P6L0 - Mus musculus (Mouse) [Source:UniprotKB/SpliceVariant;Acc:Q6P6L0-2]


Sequence tag IST14745A8HMF2
Sequence
AAGCCATCTCACCGGCCCCTTAGGGAATTTACAGGCTAGGTCAGTTTGCCTGTTTTGTTGATTGATCTGTGACCAGAACC
CAGCACAGAGTACACACTCAATCACTTACTTGCACAGACTTAAAATCTGAGACAGGGTCTCCCTATGTGGCTCTGTTGCC
TCCTAGATTCTGGGATTAAAGGCAGGCACCACTGCTCCGGGCTATTGACATTTTTAGGCATTGAGACAGAGCCTCCCTGT
GGAGCCTCAGA
Sequence Type genomic DNA
Unitrap ID UNI13134

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 100458735..100458984 250
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053559 (BC004728) NM_001033872 Small transmembrane and glycosylated protein [Source:UniProtKB/Swiss-Prot;Acc:Q99KC7]

 
Come back to gene ENSMUSG00000053559


For any suggestions or comments, please send an email to unitrap@crg.es