Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13657G6
Clone ID IST13657G6
Vector VICTR74
Project tigm

Sequence tag IST13657G6HMF1
Sequence
GAGTCACAACTAAAGGTGCTGGGAAGGGCGCAGTGTGTGTGTCCTGTAGTGCTTAAGGTTGGATGCTTGGAGTGTCTTGA
ANAGGAAAGGGAAGGTACAGCTAGGATGCATACCACCATCTCATAGCCCCAGCCATCTGGCTCCAGAGTGGCTGGCACAA
TGACAGCTGACCCANANACAGGGAGGTACAGCAGGAACTTGGAGGGTGAGAAGGCGGTGGCAGGTGTTTATCGCNACTTC
ACGTCTCATCATCCTCTGGCTTGTTTTGTGGGAGGTTCAGTCTGTTCCCCANACACTCTTCTCACAGGTTGCTAATAAAA
TGACCGTTGGCCCCTTTCTCTTTGGAGTANCTTCTTGAANGGAGGCTTGTTGGCNAACCNGCCACATTGTTATGGGGATT
GACAAATGTTTGGGGACNCATGGGATCAANTCCNCTTTTTTGCGTTNAGANTTGGCATGGGGGTGGGGGGCN
Sequence Type genomic DNA
Unitrap ID UNI20228

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127531030..127531500 443
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040054 (Baz2a) NM_054078 bromodomain adjacent to zinc finger domain, 2A Gene [Source:MGI Symbol;Acc:MGI:2151152]

 
Come back to gene ENSMUSG00000040054


For any suggestions or comments, please send an email to unitrap@crg.es