Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14664G2
Clone ID IST14664G2
Vector VICTR74
Project tigm

Sequence tag IST14664G2HMF1
Sequence
ACAGATGGTTGCGAGCCACCATGTGGGTGCTGGGAATTGAACT
Sequence Type genomic DNA
Unitrap ID UNI5330 UNI12334 UNI30787 UNI30788 UNI30789

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5776712..5776754 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 15189183..15189225 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 5950066..5950108 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023805 (Synj2) NM_011523 synaptojanin 2 Gene [Source:MGI (curated);Acc:Synj2-004]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 32031215..32031257 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 12122242..12122284 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 12299477..12299519 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021311 (Mtr) NM_001081128 5-methyltetrahydrofolate-homocysteine methyltransferase Gene [Source:MGI Symbol;Acc:MGI:894292]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 52601909..52601951 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 6355151..6355193 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 22188252..22188294 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036777 (Anln) NM_028390 anillin, actin binding protein Gene [Source:MGI Symbol;Acc:MGI:1920174]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 14409239..14409281 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 12477503..12477545 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078467 (Utrn) utrophin Gene [Source:MGI Symbol;Acc:MGI:104631]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 6828429..6828471 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 21991058..21991100 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 17511157..17511199 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 6575402..6575444 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 46623083..46623125 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88363213..88363255 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008604 (Ubqln4) NM_033526 ubiquilin 4 Gene [Source:MGI Symbol;Acc:MGI:2150152]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 11921576..11921618 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 12074549..12074591 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 43742263..43742305 41
NO GENE  


Sequence tag IST14664G2BBF1
Sequence
ACAGATGGTTGCGAGCCACCATGTGGGTGCTGGGAATTGAACT
Sequence Type genomic DNA
Unitrap ID UNI5330 UNI12334 UNI30787 UNI30788 UNI30789

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5776712..5776754 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 15189183..15189225 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 5950066..5950108 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023805 (Synj2) NM_011523 synaptojanin 2 Gene [Source:MGI (curated);Acc:Synj2-004]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 32031215..32031257 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 12122242..12122284 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 12299477..12299519 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021311 (Mtr) NM_001081128 5-methyltetrahydrofolate-homocysteine methyltransferase Gene [Source:MGI Symbol;Acc:MGI:894292]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 52601909..52601951 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 6355151..6355193 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 22188252..22188294 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036777 (Anln) NM_028390 anillin, actin binding protein Gene [Source:MGI Symbol;Acc:MGI:1920174]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 14409239..14409281 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 12477503..12477545 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078467 (Utrn) utrophin Gene [Source:MGI Symbol;Acc:MGI:104631]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 6828429..6828471 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 21991058..21991100 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 17511157..17511199 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 6575402..6575444 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 46623083..46623125 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88363213..88363255 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008604 (Ubqln4) NM_033526 ubiquilin 4 Gene [Source:MGI Symbol;Acc:MGI:2150152]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 11921576..11921618 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 12074549..12074591 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 43742263..43742305 41
NO GENE  

 
Come back to gene ENSMUSG00000008604


For any suggestions or comments, please send an email to unitrap@crg.es