Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14280C1
Clone ID IST14280C1
Vector VICTR74
Project tigm

Sequence tag IST14280C1HMF2
Sequence
TTTTTAATATGTAAGTACACTGTAGCTGTCTTCCGACACTCCAGAAGAGAGAGTCAGATCTCATTACAGGTGGTTGTGAG
CCACCATGTGGTTGCTGGGATTTGAACTCCAGACCTTCGGAAGAGCAGTCGGGTGCTCTTACCCACTGAGCCATCTCACC
AGCCCCTAATATTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 58306609..58306781 165
NO GENE  


Sequence tag IST14280C1BBF1
Sequence
TTTTTAATATGTAAGTACACTGTAGCTGTCTTCCGACACTCCAGAAGAGAGAGTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI29342

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 125067586..125067646 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 38138919..38138979 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25705594..25705654 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040940 (Arhgef1) NP_001123622 Rho guanine nucleotide exchange factor (GEF) 1 Gene [Source:MGI (curated);Acc:Arhgef1-002]

 
Come back to gene ENSMUSG00000040940


For any suggestions or comments, please send an email to unitrap@crg.es