Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14446F1
Clone ID IST14446F1
Vector VICTR74
Project tigm

Sequence tag IST14446F1BBF1
Sequence
CTGCCAAGGCTGGGGACTGTGAGTTCAAACCCCTCAACTCACATGCTCAAAAGAGAGACTCGACTCCTGGAGGTTGTCCT
CTGATCTCTACACCAGCGCTAAGACATGTGTGCCTCTGCCCAATAAATAAACGCAAAGGCTCCTGTGAAACACTATCTTC
CCCGTTGGTTCGAGACGGGGTTCTCTATGAGGCTTTGACTGTCCTGGAACTCACCCTGTAGATTAAGCTGGCCTCGAACT
CACAGAGCTCTGCCTGCCTCTGCCTCCTGAGTGCTGGGACAAAGACGGTGCTCCACCATCACTACACAGCTGCTATGAAG
TCTTTTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 134814888..134815222 335
NO GENE  


Sequence tag IST14446F1HMR1
Sequence
ACAGAATGTTGAAGAATGTTTGTTCCAAGATCTTTGAAAATCAAGAGGAGTTCTAATGATGACCTCAAAAGCGGTGAAGC
TAAAAAAAGCAAGCCAGAAGCAGGAGGCCTTCAGGTGGAGGGAGACAGAGATACTCCGGTCCACACATCAGTCACTGAGG
AAGCTGTCACAGCAGACAAGCCCGGCCATGCATCAAGCACCAACAGTCCTTCTTGCCAGTTGGCTGAGGTTTCTTCCACA
GGACCTGATGAGGGTGTGAAGGACAGCCACCCATCTGAANAGCCTGTAAAGTCGTTTTCTAAAACCCAGCGGTGGCN
Sequence Type genomic DNA
Unitrap ID UNI18641

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 138313155..138313470 314
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026404 (Ddx59) NM_026500 DEAD (Asp-Glu-Ala-Asp) box polypeptide 59 Gene [Source:MGI (curated);Acc:Ddx59-001]


Sequence tag IST14446F1HMF2
Sequence
CTGTTGAGGAAATTGCACCATGAGATATATTTTACCCTCAATTAAGCTCCCATGTTAGCCCATACGATGTTGTGTCAGAG
AATTTTACTCAGGGCAATAGTGAAGCCGTCATGTCCCTACTTAAGCCAACTTCCACTTATCAATTTCCTCTGGGGGAAGG
GATACAGTCTTTTTCCTCANACACTGCCCTATGAAACACTGCCTACGGTTCCCCACAACCTTGCTGTGCACGCCACCTGT
TTCTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 138312912..138313158 245
NO GENE  

 
Come back to gene ENSMUSG00000026404


For any suggestions or comments, please send an email to unitrap@crg.es