Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11968F10
Clone ID IST11968F10
Vector VICTR76
Project tigm

Sequence tag IST11968F10BBF1
Sequence
TTTCTATAAAGTCCTTCNCATGCGCTCCAAGCCAATACAGGGCAGGCCACTTCNGGCCGCACCCTACCCTGGCTGCCAAA
CCCCAGCGAGCTTTCTGGTTAGCTACTCAGCGCGGGGGCTGGGAAGGAGAGATGGCGAATCGGAGCCTGCGGGGCATTCT
CATCTCTCCAATCAACATCACNATCTANTTGGGCAGCACANGAATTTAAGGCTATNNTTNGGAAAGGGCGGTGGAAGGTA
TGAGGGACTGGGTCAACTCAAGAAGGGGCATANNGATAGGAGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 70481921..70482206 266
 
EST/CDNA Est Name
  AI180464.1 - BY031590.1 - CB951207.1 - CB595891.1 - AA155116.1 - BY315304.1 - BY026820.1 - BY022819.1 - BY173168.1 - BY026584.1 - BY039508.1 - BY088889.1 - BY009337.1 - BY133721.1 - CO806218.1 - BY024363.1 - W53922.1 - BY311295.1 - AA396704.1 - BY023661.1


Sequence tag IST11968F10HMF2
Sequence
TTGGGAAATGTGGCGTACGGAAGACCCACTCCCCGGCGCCGCTCGTGGGGGGCCCAAGTCCTTCTGATCGAGGCCCANCC
CGTGGACGGTGTGAGGCCGGTAGCGGCCCCCGGCGCGCCGGGCTCGGGTCTTCCCGGAGTCGGGTTGCTTGGGAATGCAG
CCCAAAGCGGGTGGTAAACTCCATCTAAGGCTAAATACCGGCACGAGACCGATAGTCAACG
Sequence Type genomic DNA
Unitrap ID UNI28357

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 147072569..147072774 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029635 (Cdk8) NM_153599 cyclin-dependent kinase 8 Gene [Source:MGI (curated);Acc:Cdk8]

 
Come back to gene ENSMUSG00000029635


For any suggestions or comments, please send an email to unitrap@crg.es