Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14524B3
Clone ID IST14524B3
Vector VICTR74
Project tigm

Sequence tag IST14524B3HMR1
Sequence
GAACTATCTGTGGCCCGAGGGGAGAGGATCATGCCACCCACCGGTTGAAGCCAAGAGATGAAAGCATCAAGGGCTCACCT
GACCAGTGTAAACTGGAGAGTACTAACTCCCTTGCAATTTACTAACATTAACCTTACGTGACCTTTCAAAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71189808..71189957 150
 
EST/CDNA Est Name
  CX221765.1


Sequence tag IST14524B3HMF1
Sequence
GTTCAGTGTAATTACAACATACTCCTGTATACGAAACCCTGCCAACTTTCATGTGTAATTTTGATTACATGTATGGGAAT
TCCAGGCTCCCATAAGGTCAATTTTGTTTTTCTCACCTCAGACAGCCAAGGCCTCACGCACGTGAGAATGCTACCTTCGA
ATGCGTTTAAAAGTTTCTGGAAATGTCAAAAGCTGTGTGCCCACTTGCATTCCCAGTATTTGCGTTGGGTTC
Sequence Type genomic DNA
Unitrap ID UNI14364

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71189581..71189811 231
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027010 (Slc25a12) NM_172436 solute carrier family 25 (mitochondrial carrier, Aralar), member 12 Gene [Source:MGI (curated);Acc:Slc25a12-001]

 
Come back to gene ENSMUSG00000027010


For any suggestions or comments, please send an email to unitrap@crg.es