Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15093G7
Clone ID IST15093G7
Vector VICTR80
Project tigm

Sequence tag IST15093G7HMF2
Sequence
ATATCAGATTCCTCCTATGTAGTAAATGCAGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI31160

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 102123914..102123948 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 78780517..78780551 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 19059853..19059887 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 41871406..41871440 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 90345304..90345338 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 20231235..20231269 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 9906853..9906887 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 3122874..3122908 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 110078585..110078619 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28722280..28722314 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074243 (AC164532.4-202)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 74552197..74552231 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_110857: 156377..156411 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166479: 11169..11203 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 23735322..23735356 35
NO GENE  


Sequence tag IST15093G7BBF1
Sequence
ATATCAGATTCCTCCTATGTAGTAAATGCAGTTAACATTCTTGAAACAGCTGGGGTAATAAAACCCTCCAGCAGAGTTGC
CAATATTTTTCGACAAATACAGTTTGTTTCATTAAATAGAAAATTCCCTGTTTATATTACTCATGTTAGGGCACACTCAG
GCCTCCCTGGTCCTATGTCTCTGGGAAATGATTTAGCAGACAAAGCCACTAAGGTTATAGCTGTTGCTCTGTCTTCCCAG
GTAAAAGCAGCAAAAGAATTTCATAAGCGCTTTCATGTGACAGCTGAGACTTTACGTCGCCCGCTTTGCATTAACTAGAA
AAGAAGCTAGAGAGATTGTTACTCAATGTCACAATTGTTGTGAATTTTTACCTGTCCCTCATGTGGGGATAAACCCTCGT
GGCATCAGGCCATTACAGGTCTGGCAAATGGATGTTACACATTTNTCCTCCTTTGGGGGAAATCNNTATTTACATGTTTC
TNTTGACACCNGCTCNGGTGTNATGTTTNNCACACCTTNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_110857: 155896..156411 485
NO GENE  

 
Come back to gene ENSMUSG00000074243


For any suggestions or comments, please send an email to unitrap@crg.es