Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12911F11
Clone ID IST12911F11
Vector VICTR76
Project tigm

Sequence tag IST12911F11HMF1
Sequence
TACTAAGGTGACTTTATTGATACCCCTCCGGGTGGGGGCTGGCAAGATCTGANATTACTGGGAAGGTATTCTTTTNACTC
CAGGAACCTCATGTCTGATGANAGAGACAGGGGATACTCCCCCACACACCCACACACACCCAGGGTTCAAGCTTAAACTG
GGCTANCACATGACATACAGATGTACTGAGGACGGGCCTGGGGAAACTGATTCNGTTACAGGTTCCTGTCACAAAGGCCA
ATACTCTACCAGTCCAGATGTTCCCTTCCTTTCTGGGACAAAGGTGCACATGGCTTTANGACTGTCATTCNCANATGCCC
CCAGGGCCCTAAATGTTCCAGGGGATGAGATTTGGGGCCTGGACAGTTGCANNATGAGTTGTGGCTGGTGANGGCTCTAT
GAACTGAGCCTCTGTGTCCCNNNTCTCCTTCCNTGNAACCTCTCTGTGCCTGGCTGGGCNNNTGTACTCCTANNANCTAA
NNGAAANTGTNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12911F11BBF1
Sequence
TACTAAGGTGACTTTATTGATACCCCTCCGGGTGGGGGCTGGCAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI25850

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100247103..100247153 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001552 (Jup) NM_010593 junction plakoglobin Gene [Source:MGI (curated);Acc:Jup-001]

 
Come back to gene ENSMUSG00000001552


For any suggestions or comments, please send an email to unitrap@crg.es