Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12518D1
Clone ID IST12518D1
Vector VICTR76
Project tigm

Sequence tag IST12518D1HMF1
Sequence
ATGTCAGATATAAGATCAACTAGAAAAAATTTAGTTTCTACATGACTGCTTTTGACTGTGTCCGTGGTATATAAATGAGC
TGAGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 154856307..154856395 89
NO GENE  


Sequence tag IST12518D1BBF1
Sequence
GTCCTCAGTCCTTCTATAGGGTTCAGCTCAGTGGCAGAGTGCCTTCCTAGTATGTGCAAGTCCCTTGGCTTATATCCCAA
CAAAGAGAGAGAGCTGTGTCTGCTTTTACTGTGCCATTGAACCAGATGCCTCATCACCATCTATCAGAAAACTGAGGCAG
GGTTGTGAATTGGAGCTTTAACAAGTTCCAGGCTAACTTTAGCTAGCCTATGGTGAGACCCCGTATTCAAATAAGCAAAC
AAAAATTGGATGATTTTTGAAATTGCATTTAATGTAGAGTTGAGAATAACGTCATATTACGTGAAGGTTTAAGGTATGTG
CACACTGATACTGTTCCCATTAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI27298

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7724042..7724390 347
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055188 (2900002K06Rik) RIKEN cDNA 2900002K06 gene Gene [Source:MGI Symbol;Acc:MGI:1917476]

 
Come back to gene ENSMUSG00000055188


For any suggestions or comments, please send an email to unitrap@crg.es