Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST14623-NL
Clone ID PST14623-NL
Vector U3NeoSV1
Project escells

Sequence tag PST14623-NL
Sequence
TGCAAGGCTCTGGGTTGGATCCTTAGCACTTGAAAGGGAAAGGTAGAAAATTGATTTGTTAATATTATTGCTACCTTTGT
ATTTGTGTGTGTATGTTTACCTTGTGTGTAAAAACTTTATTGTCAGCTTTCAGTTTCAGTGTTACCATATTTTATTCTAT
CATAAGTATTCATTTATTGTTGGTACTCTTGTAATAACGGAAGCTTTGAGAGTAATCAAAT
Sequence Type genomic DNA
Unitrap ID UNI10837

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 95375314..95375534 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032407 (2610101N10Rik) NM_026476 RIKEN cDNA 2610101N10 gene Gene [Source:MGI Symbol;Acc:MGI:1915208]

 
Come back to gene ENSMUSG00000032407


For any suggestions or comments, please send an email to unitrap@crg.es