Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11753E3
Clone ID IST11753E3
Vector VICTR76
Project tigm

Sequence tag IST11753E3BBF1
Sequence
GTGGTAAGTGTAGCCTCATGTGGGAGGTGATATCTAAGCCACAGATCCATGGATGAGTTATGTTTATAGTGGTAGAAAGC
AGAGGAAGGGAGAACCTGGACACAGGGGTGACCGTGATGTATTTATGCAAGAGAAGCGAGCAGCTTGCCTGTGGAAAGTA
GGTGAACAGATGTGATTTCTACAGTGAGTGTTAGAATCCTGCTTTGGTCAAGTTGAGGGGGGGGGGANCNAAC
Sequence Type genomic DNA
Unitrap ID UNI13763

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62634136..62634367 224
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020067 (Mypn) myopalladin Gene [Source:MGI Symbol;Acc:MGI:1916052]


Sequence tag IST11753E3HMF2
Sequence
AACTACCTCCTCGCCCCAACTGGGTTTGAATTTCTAGGATTCGAGGTGAGCGCCACCATGCCGGCCTGCCAGAGGAGCCC
ACTTGTCAAAAATGTTAAAGCCCATCTTACAAAAAAACCAAATTATATTTAATGTACACGCACACGCGTGCATTCCGCTT
TACTCAGGCGTTTCGAGGCCAGCTCACGAGCCTGAGCCGCCTTACCTATGACGCCACGTTTGCCTTAGTGCCTGTCTAGG
ACCCTTGCAGGGTGAGGCCGGAAAATACAGGGAGCTAGGAGGCGCGGCTCAGGGCTGCCGCCATTAAAGGTGCACTGCAG
GTTAAAACACATGGCATCAAAGTCCGGAACGCCCAGCGGAGGCAGTGGGGCAAGGACGGACGCTCGGGAAAGCCTAGCCT
TATTCGTCCGAGTCCCAGCGGCCCGAACGTTTANCTTCCAAAGCCCGANCACGCANGCGCGAGCGCANGCGCANGCNCNC
GCGANTGGCCCACAGCCCCACCCCGTCCTCCACGCGTTNCAACTTTGCGGTGCGCGTCTGCTGACGTCNCCTCAACNGCC
CGCTGGNCNNNNGGGNCTTTTGGGAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 7837049..7837632 546
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049742 (C330006D17Rik) RIKEN cDNA C330006D17 gene Gene [Source:MGI Symbol;Acc:MGI:1924866]

 
Come back to gene ENSMUSG00000049742


For any suggestions or comments, please send an email to unitrap@crg.es