Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13608G6
Clone ID IST13608G6
Vector VICTR74
Project tigm

Sequence tag IST13608G6BBF1
Sequence
CTTCNNNNNNCNNANCCNNACTGAAGCTGAGTTANACAGACGCACAGTAACCAAATGGGGAGTAGAACACAGAGCAGTCA
CTGGTTCATGAACACCTCCCTCTGTGACCGTTCTTGCTGGCCTCAGTCTCAGGATCCTCTTGCCTAAATGTTGGGACAGT
ATTTANTACCNAGCCCANCACTGATCCATANAAGTCCTGATTTCCTGCTCNNCNCAGATCNGT
Sequence Type genomic DNA
Unitrap ID UNI13119

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 126804925..126805125 185
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025405 (Inhbc) NM_010565 inhibin beta-C Gene [Source:MGI Symbol;Acc:MGI:105932]


Sequence tag IST13608G6HMR1
Sequence
NNNNNGATAATTGATTTTTAGGACAGCAGCAGTGGCGTTTTAGTAAATACTTAACAGCTGCTCTCCAGGTGGGGGATACC
TTAAAGCCCTGATTTGCAGTGATTTCTCTACTATAAATCCTATGGGGTCCAATGTCAAGGTTCTAATGCGGCATACGTGA
ACCCAGGTATGTCCACCACCAGCTGTCCTAAGTCCCACTAGCCTCTGATTTAGGTGAGGAGACCCAAAACCTGATGCTAA
TGGTCTAATGGCTGGGAAAGTGACATAGAGGAATCCAGAGGGGGTGACTGTATTTTGTGTATTGCTATTTTGGCTGACCC
CGGGGAACGCATCTCCTGGTTTGCATGGTTTTACCCAGTTCCACCCCATCCTGATTCTGGACTTAGCCCTTAGTGACATG
CTTTGTCAATGCCACAAAGGTAAACAAAGCATATATAGAANCTGGACAATCATTTACCCTGAAATCTGCTCTCTTGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 126805146..126805617 468
 
EST/CDNA Est Name
  CN720654.1 - CJ043694.1 - BF533968.1 - BF232704.1 - BF236906.1 - BX524706.1

 
Come back to gene CN720654.1 - CJ043694.1 - BF533968.1 - BF232704.1 - BF236906.1 - BX524706.1


For any suggestions or comments, please send an email to unitrap@crg.es