Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10184D8
Clone ID IST10184D8
Vector VICTR76
Project tigm

Sequence tag IST10184D8HMF1
Sequence
CAATGATATCCGATGCTCCGATGCCCTCTTCTGGTGTGTCTGAAGACAGCTACAGTGTACCTACATATAACAATAAATAA
ATCTTTAAAAAAAAAAAAAAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI32207

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 130193165..130193272 108
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95373973..95374080 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028109 (Hormad1) NM_026489 HORMA domain containing 1 Gene [Source:MGI (curated);Acc:Hormad1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 103214020..103214127 108
NO GENE  


Sequence tag IST10184D8BBF1
Sequence
CAATGATATCCGATGCTCCGATGCCCTCTTCTGGTGTGTCTGAAGACAGCTACAGTGTACCTACATATAACAATAAATAA
ATCTTTAAAAAAAAAAAAAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI32207

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95373973..95374079 107
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028109 (Hormad1) NM_026489 HORMA domain containing 1 Gene [Source:MGI (curated);Acc:Hormad1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 130193166..130193272 107
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 103214021..103214127 107
NO GENE  

 
Come back to gene ENSMUSG00000028109


For any suggestions or comments, please send an email to unitrap@crg.es