Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14991D7
Clone ID IST14991D7
Vector VICTR78
Project tigm

Sequence tag IST14991D7HMF1
Sequence
GAACTATACTCAATTTGGATCAACATCCCTCCATTAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 130494176..130494212 37
NO GENE  


Sequence tag IST14991D7HMR1
Sequence
GTTCCNTCTACCCTTCCNTATCTGAGATGTGTAATACCTCATAAGAATCATGGCTGACATGAATGAGGAAAGGCACTTGC
CAGTCAAGACTGACCTGAGTTCAATCCCCAGGACACATGGGAAAGCCAGATGTGTGTAGCAGCACACTTCTGTAACTCCT
CAAGATGGGAGGGAGAGGCTGAAGAATCCTCAAAGCTTGAAAGCTAGCCAACTTGAGGTACCCATAGCANCANAAATGCT
GCCTACCAATTCACTGCATTCTTAAACTGAGGACAAAGGGACCTTTAATCCAAGTTACACCAGGCAAATGTTCCTCTTTC
TGCCATTTTTTCATGACAACCTGATAATCCAAAACTGGCTATAGTGAACCTTTTATTCTGCTTGCTTTGGGACATAAAGC
TAGTCTAAAAGTATGCTTGGCNNCGCTTCCTGAAATGAACACATCTNANTNTGTGTTTTCCNNAATCCCAN
Sequence Type genomic DNA
Unitrap ID UNI5965

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 130494209..130494678 448
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074797 (Itpa) NM_025922 inosine triphosphatase (nucleoside triphosphate pyrophosphatase) Gene [Source:MGI (curated);Acc:Itpa-001]

 
Come back to gene ENSMUSG00000074797


For any suggestions or comments, please send an email to unitrap@crg.es