Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14962B8
Clone ID IST14962B8
Vector VICTR76
Project tigm

Sequence tag IST14962B8HMR1
Sequence
GTTTGTTGTTGTTATGTTTGTTTTACCNACCCAGTGAGGACAATTGTTCTGATTAATGCACTGAGTGCTCCTCAGTGACA
TGTGTCCTGCTTTGCTCTGAGCCTTGTCTCATAGCCATTAGGTAGAAAGTACTTGCAATTTACCTGAACCCAGCCTGAAG
CCACAAAACAAAATCTTGTGTCCTAAAATCCCTCTTCAGTTGCTAATATTCTGGCACTGACCACCTGTGGACAGTTTGGT
AACTCCANTGTCANCTGATTGATGGGGTATGCAAGCTACCNNNCTTGATTCCNGGAGGAAGAAGGGGAAATGCCTCCTGA
GCGCTGGATTTGGAGCTCANGCAAGCTCCAACCTTTCAAAGCAGTGAACCCAGGGTCACTGACCAGAAAGGTGGANAGGC
AGGCAGGTAANCANCAGGGATCNAGAATCTTANCCCCTCANAAGGGCTTGGCAGGGGATCANACAGGTANGCCATTGGAG
GANACACACTNNTGCTACTGAACTGGAAATCTGCANATATGGAAAAGGATTGGCCCAGGCTCGAACCATTGTGCTGTGTC
CN
Sequence Type genomic DNA
Unitrap ID UNI34803

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 176587679..176588239 521
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078877 (OTTMUSG00000016219) predicted gene, OTTMUSG00000016219 Gene [Source:MGI Symbol;Acc:MGI:3709624]


Sequence tag IST14962B8BBF1
Sequence
AAACCCACACCTATATTAGTAAAATATATCACTGTTCTGATTTGAAAAAGACCAGGCCCTTCTTGGTAGAAGGAATGGCA
TTAATAAGATAGTGTTTGACCTTGCCCCTAAGTGCTTTGTTAACTACTGANGTCTACNANGTGACNCACACNNCTACNNA
TAATGTCATGTGTTTAATATTTGTGGGCTCACTTAAATATGTCACCCAANGATTGCACATATNNNATANTACANATCCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14962B8HMF2
Sequence
AAACCCACACCTATATTAGTAAAATATATCACTGTTCTGATTTGAAAAAGACCAGGCCCTTCTTGGTAGAAGGAATGGCA
TTAATAAGATAGTGTTTGACCTTGCCCCTAAGTGCTTTGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 175027819..175027942 124
NO GENE  

 
Come back to gene ENSMUSG00000078877


For any suggestions or comments, please send an email to unitrap@crg.es