Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11298H4
Clone ID IST11298H4
Vector VICTR76
Project tigm

Sequence tag IST11298H4BBF1
Sequence
CACACNACCNTTATAATGCCTTACTCTGCGCGGACCTAAGCCTCCTTGGCTTTAGGCGTTAAGGACAACATTCTGCCCGT
CTCTCANTCGCGGTACTGCCCACCAAGCANCCGGTTTCTCGGCGGCTGGGGACAGATGTCCCCNAGCCTGTCCTGATCAC
CCACCCGGGGCTGCAGTGCGTACGTCTCCTCCAAAGCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 5066892..5067090 189
 
EST/CDNA Est Name
  CV305125.1


Sequence tag IST11298H4HMF1
Sequence
TGTGTAGTTCAGGGAAACTTCCCAGTCTGCTCTTGGA
Sequence Type genomic DNA
Unitrap ID UNI31488

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 41548763..41548798 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038332 (Sesn1) NM_001013370 sestrin 1 Gene [Source:MGI (curated);Acc:Sesn1-001]

 
Come back to gene ENSMUSG00000038332


For any suggestions or comments, please send an email to unitrap@crg.es