Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10984H11
Clone ID IST10984H11
Vector VICTR76
Project tigm

Sequence tag IST10984H11HMF1
Sequence
AGATCAACACTCCCTTGTGTTCGTGTCTGTCNCCCCGCCGATTCCTTGCCCACAGGGGCGACTGAGTCCAGTCTGCAGCA
ATCCTGTTACGTGATAAATGACTATGTACCTTCCCCAGTTCATATGCTGAAATCTAAGGCCTAAGTTAGGTATTTGGAGC
TGAGAAGTTAGGTAGGTATTANACCATCAGGATGGATTCTCCAAGCATGGTCTAAATGTGCCTGAAGAGGACACCANAGA
GCCACCTTATTCTTTCTGTCAAATAAGGATACAATAAAAAGTCTGCAATCANCAATGGTCCTTCCCAGTATCTAACTACG
CTGGTACCCTGAGTTCAAGGCCNNCCTGGTCCATGTAATGANACCNCATCTCANAGTAAAAAAGCAAGACCAGCAAGATG
TCTCAGGATCTACCACCAAGCCTGATGTGATCACCTGCATTCAAATTCCANGANNNACATAGTTNAGANAATTATCTNCC
NCANNGTTGNNCCCC

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10984H11HMR1
Sequence
ATCTGAATGTAATTTCTCAAAGCCAGCATCANACTTATATTATAGAAGAAAACAAGGAAGTTAGGTGATTCATTAAGGTC
ATCCAAGGTACATTGAGGTTACCCGATTCAAATCGACTCTTTACCCAAAACAGAGAAATGCATACACAAAAGCTGACAGG
AACCAGGCAGTGTTTACAACTGGGATTAAAAAAAATCAGTGTTTACAACTAGAATCAAAAGCAGTGTGCCCTTGCCATTG
TTAATTCACCTTCTCCCTAGGCCATTGTAAATTCCTGTGTATGGGAGTGACTCANCTGNTANNCTAAGTATTNACTCTAN
TTCTTTCNNANACCACNCNNNTNNNTN
Sequence Type genomic DNA
Unitrap ID UNI8225

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 107716135..107716470 316
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042590 (AC165281.2) NM_029665 Importin-11 (Imp11)(Ran-binding protein 11)(RanBP11) [Source:UniProtKB/Swiss-Prot;Acc:Q8K2V6]

 
Come back to gene ENSMUSG00000042590


For any suggestions or comments, please send an email to unitrap@crg.es