Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10548B11
Clone ID IST10548B11
Vector VICTR76
Project tigm

Sequence tag IST10548B11BBF1
Sequence
ACAGGTCCCACTAGCTGTTCAGTATGTGGTCTGTAGTGAGCCACTTGAACTGTGAGCAGACTCTCAGCTGTGTTTTTTAA
ATATTTTATTATTTTTATTACTATTAATTAAAAACACCTTTGTGCTGCTATAAAGCACACGCTAACCTTGAACTCCCGAT
TCTCTTGCCTCTGCCTTGTACATGCTGGGATGACAGGAGTCATGACAGCCACCATGCTGAGTGCTGAGCTCTTCCTAAGC
CTCTGTTATTGGTCAGGCCATAGAATAGACTGTGGAGAGAATTATGTGCCTTTACCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28269166..28269461 296
NO GENE  


Sequence tag IST10548B11HMF1
Sequence
GTTTCTGTGACAGGCTGGGACTCTAGTGACAGGCAGTGGGAAAACCAAGACAAGAATGANAGGCTGGGAAACAAGGCAGG
TATTTGGA
Sequence Type genomic DNA
Unitrap ID UNI2407

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123051290..123051376 85
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031822 (Gse1) NP_941073 genetic suppressor element 1 Gene [Source:MGI (curated);Acc:Gse1-002]

 
Come back to gene ENSMUSG00000031822


For any suggestions or comments, please send an email to unitrap@crg.es