Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12981E9
Clone ID IST12981E9
Vector VICTR76
Project tigm

Sequence tag IST12981E9HMF1
Sequence
AGGCAAAGTAAGAGCCACCCTCCAGGACTGGAATGAGGATTAAACAAAGCAGGAAGTCACCTGCATAGTGCCTGAGACAT
AAGTACGTACTCANAAAAGGCCCTGTTTACTGGA
Sequence Type genomic DNA
Unitrap ID UNI33107

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 33732093..33732205 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024300 (Myo1f) NM_053214 myosin IF Gene [Source:MGI Symbol;Acc:MGI:107711]

 
Come back to gene ENSMUSG00000024300


For any suggestions or comments, please send an email to unitrap@crg.es