Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11903G2
Clone ID IST11903G2
Vector VICTR76
Project tigm

Sequence tag IST11903G2HMF1
Sequence
GTTACATGATAATAGATGAATAGATAGACAGATACATAGATAGCAAAACATTGTCAGTCAGGTACATAAAAACATGCAGC
ATAGCTGACTGAGGAAGCCCCCATTGAAGCAGTCAGCTGGAGTTCCTAACAGAGAGTGTCTGGCAGAACANANTGGTCCN
TTAT
Sequence Type genomic DNA
Unitrap ID UNI30647

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 12939564..12939727 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021745 (Ptprg) NM_008981 protein tyrosine phosphatase, receptor type, G Gene [Source:MGI (curated);Acc:Ptprg-001]


Sequence tag IST11903G2BBF1
Sequence
GTTACATGATAATAGATGAATAGATAGACAGATACATAGATAGCAAAACATTGTCAGTCAGGTACATAAAAACATGCAGC
ATAGCTGACTGAGGAAGCCCCCATTGAAGCAGTCAGCTGGAGTTCCTAACAGAGAGTGTCTGGCAGAACAGANTGGTCCN
TTATTTTTTATTTTTTATTTTATTTTTTTCTAAATTCTCGGGGCTGGAAAAATATCTCAGTGGTTAAGAGTACTGACTTC
CNNAGGTCCTGAGTNNNNTNCCAGCNNCCNCATGGTGGCTCATTGTTGCNAGCNNNNCAGCGGCTCACAAGGCAGGTACA
CCTGAATANCANGCNGNCGCTGAAAAANANGGAAACTAGGGAAAANGATGANNCCNNNNNNNTGTTCTGATCNNNGNTCA
NATTTTNAATGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000021745


For any suggestions or comments, please send an email to unitrap@crg.es