Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14965E5
Clone ID IST14965E5
Vector VICTR76
Project tigm

Sequence tag IST14965E5BBF1
Sequence
AAACTAGCAGACAAACCTCAACAATTAGTCCCCTCCAGCAGCAAAGACCCTGCTGTGGCTGGATAGCCAGACTGTTCCAT
CTCTGGGAGGTAGCACTGGTCAGAGGGGACCTGCTAGAGGGGCTCTCCGCTATTTCCCTCTAACTGGGAGTTCAAGAAAG
AGCTTCCCCTAGGAGATAATCCCCAAATTAGTAACAAAGATGTTATTATTTTAGTGGTTAAGTCTTCTGTGTATACACAG
AACAAATGCTTTACAAAACAATGGCCAGGGTGAGGACACACTTCTTTACNAAGTCTCAGCCCTTGAGAGGCANAGGCAGG
TGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 121135123..121135448 322
NO GENE  


Sequence tag IST14965E5HMF1
Sequence
AAACTAGCAGACAAACCTCAACAATTAGTCCCCTCCAGCAGCAAAGACCCTGCTGTGGCTGGATAGCCAGACTGTTCCAT
CTCTGGGAGGTAGCACTGGTCAGAGGGGACCTGCTAGAGGGGCTCTCCGCTATTTCCCTCTAACTGGGAGTTCAAGAAAG
AGCTTCCCCTAGGAGATAATCCCCAAATTAGTAACAAAGATGTTATTATTTTAGTGGTTAAGTCTTCTGTGTATACACAN
AACAAATGCTTTACAAAACAATGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 121135185..121135448 262
NO GENE  


Sequence tag IST14965E5HMR1
Sequence
CCATCCCCTCATCTTGACCNAAACATAAAGAAGATGCATTTCCCANGAATAGGAGAGGTACCACACCTACCCTGGGACAC
TTTTGTTTTTTTAGAGATTTATTTTATGTCCGTGAGTACACTGGTACACTGCAGCTGTCTTCAGACACACCAGAAGAGGG
CGTCAGATCTCATTACAGATGGTTGTGAGCCACCATGTGGCTGCTGGGAACTGAACTCANGCCCTCTGGAAGAGCAGTCN
NTGCTCTTAACCGCTGANCCATCTCTCCAGCCCTGGAACACTTTCTTAACATGCTAACTGTCCTGTGGCCTTTCACAGTT
TGGGAACATTATATTGTCAGCTTCTGCCTGTANTTTTGGATTTCNNAANCNNGCTGAACAGGAAAAAATTGCCAGTGCTT
CCAGTATGAGTGTGTGTGTGTGTGTGTGTGTGNGTN
Sequence Type genomic DNA
Unitrap ID UNI1457

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 121135463..121135897 409
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053931 (Cnn3) NM_028044 calponin 3, acidic Gene [Source:MGI Symbol;Acc:MGI:1919244]

 
Come back to gene ENSMUSG00000053931


For any suggestions or comments, please send an email to unitrap@crg.es