Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10901D5
Clone ID IST10901D5
Vector VICTR76
Project tigm

Sequence tag IST10901D5BBF1
Sequence
CTANTAATAGGATTGTGGAATCCTTAGTGGTGGTTATAGTTTTTATTTTTAAGGAACAGCCGTACTGCTCTTTGTAATGC
TATACCAATTGATGTTACCATAACATATGAGAGTTCCTATCTCTGCATTTTTGGGAGTTTTGTTTGTTTGTTTGTTTGTT
TTTCGAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCCTGGAACTCACTCTGTANACCANGCTGGCCTCNAACTTANAGA
TCCACCTGCCTCTACCTCCCAAGTGCTGGGATTAAAGGCATGCGCCACCACGCCCGGCCTATCTCTGCATTTTTTGCTAN
CCCTTGTTGGTTTTNAAAATTCCTCCTCTTCCTTCTCTTTCTCCTCTTCCTCATCTTCTTTCTCATNATCTTCTANNTAN
GATCTCACTATGTANCCCACCCTTGCCTTAAATCNAGATCTG

Sequence Type genomic DNA
Unitrap ID UNI2675

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 112334885..112335325 415
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003604 (Aven) NM_028844 apoptosis, caspase activation inhibitor Gene [Source:MGI (curated);Acc:Aven-001]


Sequence tag IST10901D5HMR1
Sequence
CTAGGTATATATTCNAAGGAACTGGAGTCNAACATTTGCATTATTGTGTGTGTGGGGGGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 112334828..112334888 57
NO GENE  

 
Come back to gene ENSMUSG00000003604


For any suggestions or comments, please send an email to unitrap@crg.es