Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XS0144
Clone ID XS0144
Vector pGT0lxf
Project sanger

Sequence tag XS0144
Sequence
CAGGCAGGACCACTCTGCCCCTGCCACAGACCAGCCGGGCCACGTTGCCCCAGACTTGGATCCCCTTGTGGACACAGCCA
CCCAAGTGCCCCCAACAGCCACAGAGGAACATTATTCAGGGAGTGATCCCAGGAGGCCCGAAATGCCATCTAAAAAGCCT
ATGTCCCGAGGGGACCGATTTTCTGAGGATAGCAAATTCATCACAGTTAACCCAGCTGAGAAGAACACCTCTGGCATGCT
AAGCCGCCCCTCCCCCGGGAGGATGGAGTGGATCATCCCCCTGATTGTGGTCTCAGCCTTGACCTTCGTGTGCCTCGTCC
TCCTCATTGCCGTGCTGGTGTACTGGAGAAAATGTTTTCAGACTGCTCATTTCTATGTGGAAGACAGCAGTTCACCTCGG
GTGGTCCCCAACGAAAGTGTTCCTATTATTCCCATCCCGGATGACATGGAAGCCATTCCTGTCAAACAGTTTGGTAAACA
CATCGGTGAGCTCTATTCCAATAGCCAGCATGGCTTCTCGGAAGATTTTGAG
Sequence Type mRNA
Unitrap ID UNI2584

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 12986726..13032327 216
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021745 (Ptprg) NM_008981 protein tyrosine phosphatase, receptor type, G Gene [Source:MGI (curated);Acc:Ptprg-001]

 
Come back to gene ENSMUSG00000021745


For any suggestions or comments, please send an email to unitrap@crg.es