Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14707H1
Clone ID IST14707H1
Vector VICTR76
Project tigm

Sequence tag IST14707H1HMR1
Sequence
ATGTCTAACAAACAAATACATTCATTTGGGTACCANCCAGTAACTGAAAAAATTTTTTAAAAGACCCTAAATTTATTATT
TCAAAAGGACATTCTANATCCCTCCATAAATGGAAAGCCAGAATTTGTGACATAAATANAAAGTAATTTAAAAAATAAGC
ATAAAAATAAGCATAATAGCCGGGTGTGGTGGCACACGCACCACCCANCACTCGGGAGGCAGAGGCAGACGGATTTCTGA
GCTCAAGGCCANCCTGGTCTACAAAGTGAGTTCCGGGATAGCCAGGGCTACACANANAAACCCTGTCTCNAACCCCCCAC
CCCCCAAAAAAAGCATAATGAAAACAATGTCACAAAACTCCATCCNNAGCTGGTGGCCNNCNNAN
Sequence Type genomic DNA
Unitrap ID UNI11490

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154161878..154162255 358
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027487 (Cdk5rap1) NM_025876 CDK5 regulatory subunit associated protein 1 Gene [Source:MGI (curated);Acc:Cdk5rap1-001]


Sequence tag IST14707H1BBF1
Sequence
ACATATCTGTGTTTTACATACAGAGTAGGTTTATAATGTAAAATTACAAAGTGAGTTTTATGATTTTTGAAAAGCCAGGA
AAGTTAGTATTGTGATTTAAGGCAACAGTCACAATGACTCTGACGCATATGTATGTTCTTCTGAAGTGGCACTTTGTTAC
TGTGAGTATTTTTCCTTTGGGGTCAGGCAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154162252..154162445 194
 
EST/CDNA Est Name
  BB329807.1 - BB352498.1 - BB038133.1

 
Come back to gene BB329807.1 - BB352498.1 - BB038133.1


For any suggestions or comments, please send an email to unitrap@crg.es