Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10163H10
Clone ID IST10163H10
Vector VICTR76
Project tigm

Sequence tag IST10163H10BBF1
Sequence
TTTGCAGTGACAGACATGTACAATCACACCCTGCTTTGGCCTCTGGCCAACCATACTGACCCAAGTTACACCCGGAGTAG
GCGGTGGAATGTGTCAGTCTCTCCTGACTGCATTTTGGGGCCTTAACCTGATTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI30821

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57023910..57024048 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024209 (1700061G19Rik) NM_030141 RIKEN cDNA 1700061G19 gene Gene [Source:MGI Symbol;Acc:MGI:1925875]


Sequence tag IST10163H10HMF1
Sequence
TTTGCAGTGACAGACATGTACAATCACACCCTGCTTTGGCCTCTGGCCAACCATACTGACCCAAGTTACACCCGGAGTAG
GCGGTGGAATGTGTCAGTCTCTCCTGACTGCATTTTGGGGCCTTAACCTGAT
Sequence Type genomic DNA
Unitrap ID UNI30821

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57023910..57024039 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024209 (1700061G19Rik) NM_030141 RIKEN cDNA 1700061G19 gene Gene [Source:MGI Symbol;Acc:MGI:1925875]

 
Come back to gene ENSMUSG00000024209


For any suggestions or comments, please send an email to unitrap@crg.es