Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST14274-NL
Clone ID PST14274-NL
Vector U3NeoSV1
Project escells

Sequence tag PST14274-NL
Sequence
CATGCGCGCTGGGTTGGGCGAAGCGCACGCTTGAGGAGCTTCGGCGTCCGGGGTTGGTGTTCCGAGTCTCCTCGTTGCCA
CTAAGCAGCACGGCGTGGGACCCTACTTCGGGATTCACACATCCACTTCAGGTGACCGGCCCCGCAGCTTGCTCTCCCCG
AGGATTCGCCTTGGTTTTGTCCAGTGCGGCTAGGCCCCGGGCTACCCCCCCTTTCCCGTTCTTGCGCGGGAAGTGTCTGG
ACCCCGTCGCCACCGCCCGCTGGTGATTTCCTGCGCCCTCTCGCCAGCCGGTGTCTGCTCCTGCGAGCCAGAAACGTGGC
TGGACGGGCGGAGGAACCCCTGAAGGAACGTGG
Sequence Type genomic DNA
Unitrap ID UNI10195

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 79963038..79963389 349
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021116 (Eif2s1) NM_026114 eukaryotic translation initiation factor 2, subunit 1 alpha Gene [Source:MGI (curated);Acc:Eif2s1-001]

 
Come back to gene ENSMUSG00000021116


For any suggestions or comments, please send an email to unitrap@crg.es