Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10914H1
Clone ID IST10914H1
Vector VICTR76
Project tigm

Sequence tag IST10914H1HMR1
Sequence
TTAAAATAGAAAGTGCGGTCCATATATTTGCTTTAATCGTCATTGTTTCGAAAATACTTAGCAGGAGCAGTTTGCTGTGG
CTCATGATGTAAGAGAATTTCAGTCTGTCATGGTGGAGAAGGTGTGGTGGAGGGAGCCCCTCAGCCTGAGTCCGCAGGAG
TAGGAGGCAGTGGCTTTGTTGAATTGGGAAGTGGAAACAGGTAGCTGGGGCTGTAAATGGCTANNGCCCNNCCNTAN
Sequence Type genomic DNA
Unitrap ID UNI1452

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 109784528..109784763 226
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050199 (Lgr4) NM_172671 leucine-rich repeat-containing G protein-coupled receptor 4 Gene [Source:MGI (curated);Acc:Lgr4-002]

 
Come back to gene ENSMUSG00000050199


For any suggestions or comments, please send an email to unitrap@crg.es