Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10084G10
Clone ID IST10084G10
Vector VICTR75
Project tigm

Sequence tag IST10084G10BBF1
Sequence
AAACTAGCTGAGAATGGTAGTGGATATCTTTGACCCCCTCCTCCCCAGAGACAGGGGCAGGTGGAGGAGTGTTTAAGACC
AGCCTGTTCTATTATACACAGCTCCAAGCCAGCCAGAGCTAATATAAATGAGACTAGACTCTGTCTCAAAACTAATCAAC
TACCCAGCATTCAGGAGGCAGAGGCAGGTGGATCTCTGTGAATTCGAGGCCAGCCTGGTCTATAGAGCTAGTTCCAGGAC
AGCCAAGGCTACACAAAAGCCAAAACCAAACCAAACCAAACCACCAACATAAACGCTAACCAACCAAACAAAAAAGAAGC
ACACATATTATTTTAAAAGTCGCCAAAAGGAACACTTAAAAACTGCTAAAGCGTCTCCACCCTACCTCTTCTGGATGTTT
CCCTGTTAAGGCTCTCTTTAAACACGTCTTCTCTGCCAACAGCATTCATTACTATTGCCATTCCCTTATGTACTTCCCTT
CTAGAACCTTCTGTGAAATGTACTCGGGTCTAGTTCTTCAGGAGTTTCCCTCCACAAACTCCGTTTTTCCCCCCTCTTCC
CTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 101412227..101412789 563
 
EST/CDNA Est Name
  CA480731.1 - CA493363.1 - CA492930.1 - CA481365.1 - CX567589.1 - CD538161.1 - BY750929.1 - BB662609.1 - CN699251.1 - CN704798.1 - DV069069.1 - CJ071567.1 - CJ071492.1 - BF463082.1 - BF463876.1 - BB847736.1 - BY216715.1 - BY217334.1 - BY011255.1 - CD540291


Sequence tag IST10084G10BBR1
Sequence
GTTTTAGAGTTTGTGAGACAGGGCCTTCTGTAATTGGGTTGTGTAGCTCTAGGTGACCTTGAACTCTATCCTCCTGCCTG
TACTTCCTGAATGCTGAAAGTACAGGTTGAAACAACCATATCTGATCTTTTGGCCTCCCCAAACTAGCCCAAAAAGACTG
CTGAACTTCTGAGTCCAAGCCATCCTCCTCCTTCAACTTCTCCAGTCCCTGAAACTATAGGTATGACACCACTGGTTTTG
ATTCTAAGCAAGAAAAAGAACACCAGACTCTGGGGAAAGTTCATATATATATCACTTCTGTCCAGTCACTCCATTTTAGC
TTTTTTTTTTC
Sequence Type genomic DNA
Unitrap ID UNI10712

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 101411901..101412230 330
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017146 (Brca1) NM_009764 breast cancer 1 Gene [Source:MGI (curated);Acc:Brca1-001]

 
Come back to gene ENSMUSG00000017146


For any suggestions or comments, please send an email to unitrap@crg.es